Review



neuregulin 1 cst  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Cell Signaling Technology Inc neuregulin 1 cst
    Neuregulin 1 Cst, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/neuregulin+1+cst/Human+NRG1-beta1+Recombinant+Protein/pm40015279-604-137-138
    Average 94 stars, based on 30 article reviews
    neuregulin 1 cst - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Inhibition of PRC2 enables self-renewal of blastoid-competent naive pluripotent stem cells from chimpanzee.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins MEK inhibitor PD0325901 abcr; FUJIFILM Wako Cat# AB 253775; Cat# 162-25291 Tankyrase inhibitor XAV939 Cell Guidance Systems; TCI Cat# SMS38-200; Cat#X0077 PKC inhibitor Gö6983 Bio-Techne; FUJIFILM Wako Cat# 2285; Cat# 074-06443 Rock inhibitor Y-27632 Merck Chemicals; FUJIFILM Wako Cat# 688000; Cat# 034-24024 LIF Qkine; PeproTech Cat# Qk036; Cat# 300-05 Activin-A Qkine; PeproTech Cat# Qk005; Cat# AF-120-14E EPZ-6438 (Tazemetostat) MedChemExpress Cat# HY-13803 IL6 ORIENTAL YEAST Cat# 4708200 Activin receptor inhibitor A83-01 Generon; FUJIFILM Wako Cat# A12358-50; Cat# 039-24111 BMP receptor inhibitor LDN-193189 Axon Medchem Cat# Axon 1509 Oleoyl-L-alpha-lysophosphatidic acid (LPA) Sigma Cat# L7260 A83-01 Generon; FUJIFILM Wako Cat# A12358-50; Cat# 039-24111 FGF2 Qkine; Katayama Chemical Cat# Qk002; Cat# 160-0010-3 GSK inhibitor CHIR99021 abcr Cat# AB 253776 VPA Sigma Cat# P4543 EGF Peprotech Cat# AF-100-15 Forskolin Merck Cat# 344282 Neuregulin-1 CST Cat# 26941 GSK126 ApexBio Cat# A3446 GSK343 Sigma Cat# SML-0766 UNC1999 Selleck Cat# S7165 StemRNA 3rd Gen Reprogramming Kit StemRNA Cat# 00-0076 Lipofectamine RNAiMAX Transfection Reagent Thermo Cat# 13778150 TrueCut Cas9 Protein v2 ThermoFisher Scientific Cat# A36498 N2B27 Made in-house N/A NDiff 227 Takara Cat# Y40002 Accutase Millipore Cat# SCR005 TrypLETM Express Enzyme Thermo Fisher Scientific Cat# 12604021 D-MEM high Glucose FUJIFILM Wako Cat# 044-29765 Opti-MEM I Reduced Serum Medium Gibco Cat# 31985062 0.25% trypsin-EDTA Thermo Fisher Scientific Cat# 25200056 MEM-alpha Thermo Fisher Scientific Cat# 11900016 Fetal bovine serum Corning Cat# 35-010-CV Geltrex Thermo Fisher Scientific Cat# A1413302 Gelatin from porcine skin Sigma Cat# G1890 Critical commercial assays StemRNA 3rd Gen Reprogramming Kit ReproCell Cat# 00-0076 Neon 10mL transfection kit Thermo Fisher Scientific Cat# MPK1096 Deposited data scRNAseq Yanagida et al.20 GEO: GSE171820 Raw sequence data This paper SRA: PRJNA1086168 Bulk RNA-seq This paper GEO: GSE264735 scRNA-seq This paper GEO: GSE278810 Whole genome bisulfite sequencing This paper GEO: GSE282157 Experimental models: Cell lines Chimpanzee fibroblasts and blood cells This paper Great Ape Information Network (GAIN) (https://shigen.nig.ac.jp/gain/top.jsp) ID: 0306, 0439, 0439, 0027 Mouse embryo fibroblasts Prepared in-house N/A (Continued on next page) Cell Stem Cell 32, 1–13.e1–e8, April 3, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Leo#9 iPSC This paper N/A Pen#23 iPSC This paper N/A Pico#16 iPSC This paper N/A Ume#6 iPSC This paper N/A Ja-C12 iPSC This paper N/A Leo#9-cR naı̈ve iPSC This paper N/A Pen#23-cR naı̈ve iPSC This paper N/A Pico#16-cR naı̈ve iPSC This paper N/A Ume#6-cR naı̈ve iPSC This paper N/A CPR1 naı̈ve iPSC This paper N/A CP127 naı̈ve iPSC This paper N/A CPU6 R1 naı̈ve iPSC This paper N/A TCP1 naı̈ve iPSC This paper N/A JB-R1 naı̈ve iPSC This paper N/A HNES1 Guo et al.12 hPSCreg: CAMe001-A HNES1-GATA3-cas9 Guo et al.18 N/A hniPSC 75.1c2 Bredenkamp et al.14 hPSCreg: CSCIi002-A Experimental models: Organisms/strains NSG mice Jackson Laboratory cat#005557 Oligonucleotides TrueGuide tracrRNA Thermo Fisher Scientific Cat# A35508 cpEZH2-gRNAe7-F TCTTCTGCTGTGCCCTTATC N/A cpEZH2-gRNAe7-R GATAAGGGCACAGCAGAAGA N/A cpEZH2-gRNAset-F ATTGCTGGCACCATCTGACG N/A cpEZH2-gRNAset-R CGTCAGATGGTGCCAGCAAT N/A cpEEDKO-gRNAe5-F ATGGCTCGTATTGCTATCAT N/A cpEEDKO-gRNAe5-R ATGATAGCAATACGAGCCAT N/A cpSUZ12KO-gRNA-F TATGGAAATACAGACGATTG N/A cpSUZ12KO-gRNA-R CAATCGTCTGTATTTCCATA N/A Software and algorithms Fiji Schindelin et al.67 https://fiji.sc/ Cell Ranger v7.1.0 Zheng et al.68 https://support.10xgenomics.com/single- cell-gene-expression/software/downloads/latest Scanpy Wolf et al.69 https://github.com/theislab/scanpy PyDESeq2 Muzellec et al.70 https://github.com/owkin/PyDESeq2 STAR v.2.7.9a Dobin et al.71 https://github.com/alexdobin/STAR Fastp Chen et al.72 https://github.com/OpenGene/fastp FeatureCounts (Subread v2.0.2) Liao et al.73 http://subread.sourceforge.netge.net/ Bismark Krueger and Andrews74 https://github.com/FelixKrueger/Bismark methylKit (v1.30.0) Akalin et al.75 https://github.com/al2na/methylKit

    Transfection:

    Article Title: Inhibition of PRC2 enables self-renewal of blastoid-competent naive pluripotent stem cells from chimpanzee.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins MEK inhibitor PD0325901 abcr; FUJIFILM Wako Cat# AB 253775; Cat# 162-25291 Tankyrase inhibitor XAV939 Cell Guidance Systems; TCI Cat# SMS38-200; Cat#X0077 PKC inhibitor Gö6983 Bio-Techne; FUJIFILM Wako Cat# 2285; Cat# 074-06443 Rock inhibitor Y-27632 Merck Chemicals; FUJIFILM Wako Cat# 688000; Cat# 034-24024 LIF Qkine; PeproTech Cat# Qk036; Cat# 300-05 Activin-A Qkine; PeproTech Cat# Qk005; Cat# AF-120-14E EPZ-6438 (Tazemetostat) MedChemExpress Cat# HY-13803 IL6 ORIENTAL YEAST Cat# 4708200 Activin receptor inhibitor A83-01 Generon; FUJIFILM Wako Cat# A12358-50; Cat# 039-24111 BMP receptor inhibitor LDN-193189 Axon Medchem Cat# Axon 1509 Oleoyl-L-alpha-lysophosphatidic acid (LPA) Sigma Cat# L7260 A83-01 Generon; FUJIFILM Wako Cat# A12358-50; Cat# 039-24111 FGF2 Qkine; Katayama Chemical Cat# Qk002; Cat# 160-0010-3 GSK inhibitor CHIR99021 abcr Cat# AB 253776 VPA Sigma Cat# P4543 EGF Peprotech Cat# AF-100-15 Forskolin Merck Cat# 344282 Neuregulin-1 CST Cat# 26941 GSK126 ApexBio Cat# A3446 GSK343 Sigma Cat# SML-0766 UNC1999 Selleck Cat# S7165 StemRNA 3rd Gen Reprogramming Kit StemRNA Cat# 00-0076 Lipofectamine RNAiMAX Transfection Reagent Thermo Cat# 13778150 TrueCut Cas9 Protein v2 ThermoFisher Scientific Cat# A36498 N2B27 Made in-house N/A NDiff 227 Takara Cat# Y40002 Accutase Millipore Cat# SCR005 TrypLETM Express Enzyme Thermo Fisher Scientific Cat# 12604021 D-MEM high Glucose FUJIFILM Wako Cat# 044-29765 Opti-MEM I Reduced Serum Medium Gibco Cat# 31985062 0.25% trypsin-EDTA Thermo Fisher Scientific Cat# 25200056 MEM-alpha Thermo Fisher Scientific Cat# 11900016 Fetal bovine serum Corning Cat# 35-010-CV Geltrex Thermo Fisher Scientific Cat# A1413302 Gelatin from porcine skin Sigma Cat# G1890 Critical commercial assays StemRNA 3rd Gen Reprogramming Kit ReproCell Cat# 00-0076 Neon 10mL transfection kit Thermo Fisher Scientific Cat# MPK1096 Deposited data scRNAseq Yanagida et al.20 GEO: GSE171820 Raw sequence data This paper SRA: PRJNA1086168 Bulk RNA-seq This paper GEO: GSE264735 scRNA-seq This paper GEO: GSE278810 Whole genome bisulfite sequencing This paper GEO: GSE282157 Experimental models: Cell lines Chimpanzee fibroblasts and blood cells This paper Great Ape Information Network (GAIN) (https://shigen.nig.ac.jp/gain/top.jsp) ID: 0306, 0439, 0439, 0027 Mouse embryo fibroblasts Prepared in-house N/A (Continued on next page) Cell Stem Cell 32, 1–13.e1–e8, April 3, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Leo#9 iPSC This paper N/A Pen#23 iPSC This paper N/A Pico#16 iPSC This paper N/A Ume#6 iPSC This paper N/A Ja-C12 iPSC This paper N/A Leo#9-cR naı̈ve iPSC This paper N/A Pen#23-cR naı̈ve iPSC This paper N/A Pico#16-cR naı̈ve iPSC This paper N/A Ume#6-cR naı̈ve iPSC This paper N/A CPR1 naı̈ve iPSC This paper N/A CP127 naı̈ve iPSC This paper N/A CPU6 R1 naı̈ve iPSC This paper N/A TCP1 naı̈ve iPSC This paper N/A JB-R1 naı̈ve iPSC This paper N/A HNES1 Guo et al.12 hPSCreg: CAMe001-A HNES1-GATA3-cas9 Guo et al.18 N/A hniPSC 75.1c2 Bredenkamp et al.14 hPSCreg: CSCIi002-A Experimental models: Organisms/strains NSG mice Jackson Laboratory cat#005557 Oligonucleotides TrueGuide tracrRNA Thermo Fisher Scientific Cat# A35508 cpEZH2-gRNAe7-F TCTTCTGCTGTGCCCTTATC N/A cpEZH2-gRNAe7-R GATAAGGGCACAGCAGAAGA N/A cpEZH2-gRNAset-F ATTGCTGGCACCATCTGACG N/A cpEZH2-gRNAset-R CGTCAGATGGTGCCAGCAAT N/A cpEEDKO-gRNAe5-F ATGGCTCGTATTGCTATCAT N/A cpEEDKO-gRNAe5-R ATGATAGCAATACGAGCCAT N/A cpSUZ12KO-gRNA-F TATGGAAATACAGACGATTG N/A cpSUZ12KO-gRNA-R CAATCGTCTGTATTTCCATA N/A Software and algorithms Fiji Schindelin et al.67 https://fiji.sc/ Cell Ranger v7.1.0 Zheng et al.68 https://support.10xgenomics.com/single- cell-gene-expression/software/downloads/latest Scanpy Wolf et al.69 https://github.com/theislab/scanpy PyDESeq2 Muzellec et al.70 https://github.com/owkin/PyDESeq2 STAR v.2.7.9a Dobin et al.71 https://github.com/alexdobin/STAR Fastp Chen et al.72 https://github.com/OpenGene/fastp FeatureCounts (Subread v2.0.2) Liao et al.73 http://subread.sourceforge.netge.net/ Bismark Krueger and Andrews74 https://github.com/FelixKrueger/Bismark methylKit (v1.30.0) Akalin et al.75 https://github.com/al2na/methylKit

    Sequencing:

    Article Title: Inhibition of PRC2 enables self-renewal of blastoid-competent naive pluripotent stem cells from chimpanzee.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins MEK inhibitor PD0325901 abcr; FUJIFILM Wako Cat# AB 253775; Cat# 162-25291 Tankyrase inhibitor XAV939 Cell Guidance Systems; TCI Cat# SMS38-200; Cat#X0077 PKC inhibitor Gö6983 Bio-Techne; FUJIFILM Wako Cat# 2285; Cat# 074-06443 Rock inhibitor Y-27632 Merck Chemicals; FUJIFILM Wako Cat# 688000; Cat# 034-24024 LIF Qkine; PeproTech Cat# Qk036; Cat# 300-05 Activin-A Qkine; PeproTech Cat# Qk005; Cat# AF-120-14E EPZ-6438 (Tazemetostat) MedChemExpress Cat# HY-13803 IL6 ORIENTAL YEAST Cat# 4708200 Activin receptor inhibitor A83-01 Generon; FUJIFILM Wako Cat# A12358-50; Cat# 039-24111 BMP receptor inhibitor LDN-193189 Axon Medchem Cat# Axon 1509 Oleoyl-L-alpha-lysophosphatidic acid (LPA) Sigma Cat# L7260 A83-01 Generon; FUJIFILM Wako Cat# A12358-50; Cat# 039-24111 FGF2 Qkine; Katayama Chemical Cat# Qk002; Cat# 160-0010-3 GSK inhibitor CHIR99021 abcr Cat# AB 253776 VPA Sigma Cat# P4543 EGF Peprotech Cat# AF-100-15 Forskolin Merck Cat# 344282 Neuregulin-1 CST Cat# 26941 GSK126 ApexBio Cat# A3446 GSK343 Sigma Cat# SML-0766 UNC1999 Selleck Cat# S7165 StemRNA 3rd Gen Reprogramming Kit StemRNA Cat# 00-0076 Lipofectamine RNAiMAX Transfection Reagent Thermo Cat# 13778150 TrueCut Cas9 Protein v2 ThermoFisher Scientific Cat# A36498 N2B27 Made in-house N/A NDiff 227 Takara Cat# Y40002 Accutase Millipore Cat# SCR005 TrypLETM Express Enzyme Thermo Fisher Scientific Cat# 12604021 D-MEM high Glucose FUJIFILM Wako Cat# 044-29765 Opti-MEM I Reduced Serum Medium Gibco Cat# 31985062 0.25% trypsin-EDTA Thermo Fisher Scientific Cat# 25200056 MEM-alpha Thermo Fisher Scientific Cat# 11900016 Fetal bovine serum Corning Cat# 35-010-CV Geltrex Thermo Fisher Scientific Cat# A1413302 Gelatin from porcine skin Sigma Cat# G1890 Critical commercial assays StemRNA 3rd Gen Reprogramming Kit ReproCell Cat# 00-0076 Neon 10mL transfection kit Thermo Fisher Scientific Cat# MPK1096 Deposited data scRNAseq Yanagida et al.20 GEO: GSE171820 Raw sequence data This paper SRA: PRJNA1086168 Bulk RNA-seq This paper GEO: GSE264735 scRNA-seq This paper GEO: GSE278810 Whole genome bisulfite sequencing This paper GEO: GSE282157 Experimental models: Cell lines Chimpanzee fibroblasts and blood cells This paper Great Ape Information Network (GAIN) (https://shigen.nig.ac.jp/gain/top.jsp) ID: 0306, 0439, 0439, 0027 Mouse embryo fibroblasts Prepared in-house N/A (Continued on next page) Cell Stem Cell 32, 1–13.e1–e8, April 3, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Leo#9 iPSC This paper N/A Pen#23 iPSC This paper N/A Pico#16 iPSC This paper N/A Ume#6 iPSC This paper N/A Ja-C12 iPSC This paper N/A Leo#9-cR naı̈ve iPSC This paper N/A Pen#23-cR naı̈ve iPSC This paper N/A Pico#16-cR naı̈ve iPSC This paper N/A Ume#6-cR naı̈ve iPSC This paper N/A CPR1 naı̈ve iPSC This paper N/A CP127 naı̈ve iPSC This paper N/A CPU6 R1 naı̈ve iPSC This paper N/A TCP1 naı̈ve iPSC This paper N/A JB-R1 naı̈ve iPSC This paper N/A HNES1 Guo et al.12 hPSCreg: CAMe001-A HNES1-GATA3-cas9 Guo et al.18 N/A hniPSC 75.1c2 Bredenkamp et al.14 hPSCreg: CSCIi002-A Experimental models: Organisms/strains NSG mice Jackson Laboratory cat#005557 Oligonucleotides TrueGuide tracrRNA Thermo Fisher Scientific Cat# A35508 cpEZH2-gRNAe7-F TCTTCTGCTGTGCCCTTATC N/A cpEZH2-gRNAe7-R GATAAGGGCACAGCAGAAGA N/A cpEZH2-gRNAset-F ATTGCTGGCACCATCTGACG N/A cpEZH2-gRNAset-R CGTCAGATGGTGCCAGCAAT N/A cpEEDKO-gRNAe5-F ATGGCTCGTATTGCTATCAT N/A cpEEDKO-gRNAe5-R ATGATAGCAATACGAGCCAT N/A cpSUZ12KO-gRNA-F TATGGAAATACAGACGATTG N/A cpSUZ12KO-gRNA-R CAATCGTCTGTATTTCCATA N/A Software and algorithms Fiji Schindelin et al.67 https://fiji.sc/ Cell Ranger v7.1.0 Zheng et al.68 https://support.10xgenomics.com/single- cell-gene-expression/software/downloads/latest Scanpy Wolf et al.69 https://github.com/theislab/scanpy PyDESeq2 Muzellec et al.70 https://github.com/owkin/PyDESeq2 STAR v.2.7.9a Dobin et al.71 https://github.com/alexdobin/STAR Fastp Chen et al.72 https://github.com/OpenGene/fastp FeatureCounts (Subread v2.0.2) Liao et al.73 http://subread.sourceforge.netge.net/ Bismark Krueger and Andrews74 https://github.com/FelixKrueger/Bismark methylKit (v1.30.0) Akalin et al.75 https://github.com/al2na/methylKit

    RNA Sequencing:

    Article Title: Inhibition of PRC2 enables self-renewal of blastoid-competent naive pluripotent stem cells from chimpanzee.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins MEK inhibitor PD0325901 abcr; FUJIFILM Wako Cat# AB 253775; Cat# 162-25291 Tankyrase inhibitor XAV939 Cell Guidance Systems; TCI Cat# SMS38-200; Cat#X0077 PKC inhibitor Gö6983 Bio-Techne; FUJIFILM Wako Cat# 2285; Cat# 074-06443 Rock inhibitor Y-27632 Merck Chemicals; FUJIFILM Wako Cat# 688000; Cat# 034-24024 LIF Qkine; PeproTech Cat# Qk036; Cat# 300-05 Activin-A Qkine; PeproTech Cat# Qk005; Cat# AF-120-14E EPZ-6438 (Tazemetostat) MedChemExpress Cat# HY-13803 IL6 ORIENTAL YEAST Cat# 4708200 Activin receptor inhibitor A83-01 Generon; FUJIFILM Wako Cat# A12358-50; Cat# 039-24111 BMP receptor inhibitor LDN-193189 Axon Medchem Cat# Axon 1509 Oleoyl-L-alpha-lysophosphatidic acid (LPA) Sigma Cat# L7260 A83-01 Generon; FUJIFILM Wako Cat# A12358-50; Cat# 039-24111 FGF2 Qkine; Katayama Chemical Cat# Qk002; Cat# 160-0010-3 GSK inhibitor CHIR99021 abcr Cat# AB 253776 VPA Sigma Cat# P4543 EGF Peprotech Cat# AF-100-15 Forskolin Merck Cat# 344282 Neuregulin-1 CST Cat# 26941 GSK126 ApexBio Cat# A3446 GSK343 Sigma Cat# SML-0766 UNC1999 Selleck Cat# S7165 StemRNA 3rd Gen Reprogramming Kit StemRNA Cat# 00-0076 Lipofectamine RNAiMAX Transfection Reagent Thermo Cat# 13778150 TrueCut Cas9 Protein v2 ThermoFisher Scientific Cat# A36498 N2B27 Made in-house N/A NDiff 227 Takara Cat# Y40002 Accutase Millipore Cat# SCR005 TrypLETM Express Enzyme Thermo Fisher Scientific Cat# 12604021 D-MEM high Glucose FUJIFILM Wako Cat# 044-29765 Opti-MEM I Reduced Serum Medium Gibco Cat# 31985062 0.25% trypsin-EDTA Thermo Fisher Scientific Cat# 25200056 MEM-alpha Thermo Fisher Scientific Cat# 11900016 Fetal bovine serum Corning Cat# 35-010-CV Geltrex Thermo Fisher Scientific Cat# A1413302 Gelatin from porcine skin Sigma Cat# G1890 Critical commercial assays StemRNA 3rd Gen Reprogramming Kit ReproCell Cat# 00-0076 Neon 10mL transfection kit Thermo Fisher Scientific Cat# MPK1096 Deposited data scRNAseq Yanagida et al.20 GEO: GSE171820 Raw sequence data This paper SRA: PRJNA1086168 Bulk RNA-seq This paper GEO: GSE264735 scRNA-seq This paper GEO: GSE278810 Whole genome bisulfite sequencing This paper GEO: GSE282157 Experimental models: Cell lines Chimpanzee fibroblasts and blood cells This paper Great Ape Information Network (GAIN) (https://shigen.nig.ac.jp/gain/top.jsp) ID: 0306, 0439, 0439, 0027 Mouse embryo fibroblasts Prepared in-house N/A (Continued on next page) Cell Stem Cell 32, 1–13.e1–e8, April 3, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Leo#9 iPSC This paper N/A Pen#23 iPSC This paper N/A Pico#16 iPSC This paper N/A Ume#6 iPSC This paper N/A Ja-C12 iPSC This paper N/A Leo#9-cR naı̈ve iPSC This paper N/A Pen#23-cR naı̈ve iPSC This paper N/A Pico#16-cR naı̈ve iPSC This paper N/A Ume#6-cR naı̈ve iPSC This paper N/A CPR1 naı̈ve iPSC This paper N/A CP127 naı̈ve iPSC This paper N/A CPU6 R1 naı̈ve iPSC This paper N/A TCP1 naı̈ve iPSC This paper N/A JB-R1 naı̈ve iPSC This paper N/A HNES1 Guo et al.12 hPSCreg: CAMe001-A HNES1-GATA3-cas9 Guo et al.18 N/A hniPSC 75.1c2 Bredenkamp et al.14 hPSCreg: CSCIi002-A Experimental models: Organisms/strains NSG mice Jackson Laboratory cat#005557 Oligonucleotides TrueGuide tracrRNA Thermo Fisher Scientific Cat# A35508 cpEZH2-gRNAe7-F TCTTCTGCTGTGCCCTTATC N/A cpEZH2-gRNAe7-R GATAAGGGCACAGCAGAAGA N/A cpEZH2-gRNAset-F ATTGCTGGCACCATCTGACG N/A cpEZH2-gRNAset-R CGTCAGATGGTGCCAGCAAT N/A cpEEDKO-gRNAe5-F ATGGCTCGTATTGCTATCAT N/A cpEEDKO-gRNAe5-R ATGATAGCAATACGAGCCAT N/A cpSUZ12KO-gRNA-F TATGGAAATACAGACGATTG N/A cpSUZ12KO-gRNA-R CAATCGTCTGTATTTCCATA N/A Software and algorithms Fiji Schindelin et al.67 https://fiji.sc/ Cell Ranger v7.1.0 Zheng et al.68 https://support.10xgenomics.com/single- cell-gene-expression/software/downloads/latest Scanpy Wolf et al.69 https://github.com/theislab/scanpy PyDESeq2 Muzellec et al.70 https://github.com/owkin/PyDESeq2 STAR v.2.7.9a Dobin et al.71 https://github.com/alexdobin/STAR Fastp Chen et al.72 https://github.com/OpenGene/fastp FeatureCounts (Subread v2.0.2) Liao et al.73 http://subread.sourceforge.netge.net/ Bismark Krueger and Andrews74 https://github.com/FelixKrueger/Bismark methylKit (v1.30.0) Akalin et al.75 https://github.com/al2na/methylKit

    Methylation Sequencing:

    Article Title: Inhibition of PRC2 enables self-renewal of blastoid-competent naive pluripotent stem cells from chimpanzee.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins MEK inhibitor PD0325901 abcr; FUJIFILM Wako Cat# AB 253775; Cat# 162-25291 Tankyrase inhibitor XAV939 Cell Guidance Systems; TCI Cat# SMS38-200; Cat#X0077 PKC inhibitor Gö6983 Bio-Techne; FUJIFILM Wako Cat# 2285; Cat# 074-06443 Rock inhibitor Y-27632 Merck Chemicals; FUJIFILM Wako Cat# 688000; Cat# 034-24024 LIF Qkine; PeproTech Cat# Qk036; Cat# 300-05 Activin-A Qkine; PeproTech Cat# Qk005; Cat# AF-120-14E EPZ-6438 (Tazemetostat) MedChemExpress Cat# HY-13803 IL6 ORIENTAL YEAST Cat# 4708200 Activin receptor inhibitor A83-01 Generon; FUJIFILM Wako Cat# A12358-50; Cat# 039-24111 BMP receptor inhibitor LDN-193189 Axon Medchem Cat# Axon 1509 Oleoyl-L-alpha-lysophosphatidic acid (LPA) Sigma Cat# L7260 A83-01 Generon; FUJIFILM Wako Cat# A12358-50; Cat# 039-24111 FGF2 Qkine; Katayama Chemical Cat# Qk002; Cat# 160-0010-3 GSK inhibitor CHIR99021 abcr Cat# AB 253776 VPA Sigma Cat# P4543 EGF Peprotech Cat# AF-100-15 Forskolin Merck Cat# 344282 Neuregulin-1 CST Cat# 26941 GSK126 ApexBio Cat# A3446 GSK343 Sigma Cat# SML-0766 UNC1999 Selleck Cat# S7165 StemRNA 3rd Gen Reprogramming Kit StemRNA Cat# 00-0076 Lipofectamine RNAiMAX Transfection Reagent Thermo Cat# 13778150 TrueCut Cas9 Protein v2 ThermoFisher Scientific Cat# A36498 N2B27 Made in-house N/A NDiff 227 Takara Cat# Y40002 Accutase Millipore Cat# SCR005 TrypLETM Express Enzyme Thermo Fisher Scientific Cat# 12604021 D-MEM high Glucose FUJIFILM Wako Cat# 044-29765 Opti-MEM I Reduced Serum Medium Gibco Cat# 31985062 0.25% trypsin-EDTA Thermo Fisher Scientific Cat# 25200056 MEM-alpha Thermo Fisher Scientific Cat# 11900016 Fetal bovine serum Corning Cat# 35-010-CV Geltrex Thermo Fisher Scientific Cat# A1413302 Gelatin from porcine skin Sigma Cat# G1890 Critical commercial assays StemRNA 3rd Gen Reprogramming Kit ReproCell Cat# 00-0076 Neon 10mL transfection kit Thermo Fisher Scientific Cat# MPK1096 Deposited data scRNAseq Yanagida et al.20 GEO: GSE171820 Raw sequence data This paper SRA: PRJNA1086168 Bulk RNA-seq This paper GEO: GSE264735 scRNA-seq This paper GEO: GSE278810 Whole genome bisulfite sequencing This paper GEO: GSE282157 Experimental models: Cell lines Chimpanzee fibroblasts and blood cells This paper Great Ape Information Network (GAIN) (https://shigen.nig.ac.jp/gain/top.jsp) ID: 0306, 0439, 0439, 0027 Mouse embryo fibroblasts Prepared in-house N/A (Continued on next page) Cell Stem Cell 32, 1–13.e1–e8, April 3, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Leo#9 iPSC This paper N/A Pen#23 iPSC This paper N/A Pico#16 iPSC This paper N/A Ume#6 iPSC This paper N/A Ja-C12 iPSC This paper N/A Leo#9-cR naı̈ve iPSC This paper N/A Pen#23-cR naı̈ve iPSC This paper N/A Pico#16-cR naı̈ve iPSC This paper N/A Ume#6-cR naı̈ve iPSC This paper N/A CPR1 naı̈ve iPSC This paper N/A CP127 naı̈ve iPSC This paper N/A CPU6 R1 naı̈ve iPSC This paper N/A TCP1 naı̈ve iPSC This paper N/A JB-R1 naı̈ve iPSC This paper N/A HNES1 Guo et al.12 hPSCreg: CAMe001-A HNES1-GATA3-cas9 Guo et al.18 N/A hniPSC 75.1c2 Bredenkamp et al.14 hPSCreg: CSCIi002-A Experimental models: Organisms/strains NSG mice Jackson Laboratory cat#005557 Oligonucleotides TrueGuide tracrRNA Thermo Fisher Scientific Cat# A35508 cpEZH2-gRNAe7-F TCTTCTGCTGTGCCCTTATC N/A cpEZH2-gRNAe7-R GATAAGGGCACAGCAGAAGA N/A cpEZH2-gRNAset-F ATTGCTGGCACCATCTGACG N/A cpEZH2-gRNAset-R CGTCAGATGGTGCCAGCAAT N/A cpEEDKO-gRNAe5-F ATGGCTCGTATTGCTATCAT N/A cpEEDKO-gRNAe5-R ATGATAGCAATACGAGCCAT N/A cpSUZ12KO-gRNA-F TATGGAAATACAGACGATTG N/A cpSUZ12KO-gRNA-R CAATCGTCTGTATTTCCATA N/A Software and algorithms Fiji Schindelin et al.67 https://fiji.sc/ Cell Ranger v7.1.0 Zheng et al.68 https://support.10xgenomics.com/single- cell-gene-expression/software/downloads/latest Scanpy Wolf et al.69 https://github.com/theislab/scanpy PyDESeq2 Muzellec et al.70 https://github.com/owkin/PyDESeq2 STAR v.2.7.9a Dobin et al.71 https://github.com/alexdobin/STAR Fastp Chen et al.72 https://github.com/OpenGene/fastp FeatureCounts (Subread v2.0.2) Liao et al.73 http://subread.sourceforge.netge.net/ Bismark Krueger and Andrews74 https://github.com/FelixKrueger/Bismark methylKit (v1.30.0) Akalin et al.75 https://github.com/al2na/methylKit



    Similar Products

    94
    Cell Signaling Technology Inc neuregulin 1 cst
    Neuregulin 1 Cst, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/neuregulin+1+cst/Human+NRG1-beta1+Recombinant+Protein/pm40015279-604-137-138
    Average 94 stars, based on 1 article reviews
    neuregulin 1 cst - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results